Sequence retrieval

Genome: Burkholderia rhizoxinica HKI 454
Start position: 1301427
End position: 1301471
Length: 45

DNA sequence
>NC_014722, from 1301427 to 1301471 (45 bp); Burkholderia rhizoxinica HKI 454 CAGAATCAGCAGAATCAGCAGAATCAGCAGAATCAGCAGAATCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1300551-1303043	Sequence	RBRH_03665 - DNA REPAIR HELICASE (RAD3/RAD15/XPD FAMILY)