Sequence retrieval

Genome: Burkholderia rhizoxinica HKI 454
Start position: 1301355
End position: 1301408
Length: 54

DNA sequence
>NC_014722, from 1301355 to 1301408 (54 bp); Burkholderia rhizoxinica HKI 454 CAGAACCAACAGAACCAACAGAACCAACAGAACCAACAGAACCAACAGAACCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1300551-1303043	Sequence	RBRH_03665 - DNA REPAIR HELICASE (RAD3/RAD15/XPD FAMILY)