Sequence retrieval

Genome: Burkholderia rhizoxinica HKI 454
Start position: 1277530
End position: 1277593
Length: 64

DNA sequence
>NC_014722, from 1277530 to 1277593 (64 bp); Burkholderia rhizoxinica HKI 454 ACAGCACTACAGCACTACAGCACTACAGCACTACAGCACTACAGCACTACAGCACTACAGCACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1277593-1279578	Sequence	RBRH_03686 - PhoH protein (Protein is coded in complementary strand; from 1279578 to 1277593)