Sequence retrieval

Genome: Leadbetterella byssophila DSM 17132
Start position: 3209247
End position: 3209273
Length: 27

DNA sequence
>NC_014655, from 3209247 to 3209273 (27 bp); Leadbetterella byssophila DSM 17132 AGGACCTTGTGGACCTTGAGGACCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3208753-3209385	Sequence	Lbys_2847 - collagen triple helix repeat-containing protein (Protein is coded in complementary strand; from 3209385 to 3208753)