Sequence retrieval

Genome: Leadbetterella byssophila DSM 17132
Start position: 3171027
End position: 3171053
Length: 27

DNA sequence
>NC_014655, from 3171027 to 3171053 (27 bp); Leadbetterella byssophila DSM 17132 GAGGGCCTTGAGGGCCTACAGGGCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3170597-3171109	Sequence	Lbys_2816 - hypothetical protein (Protein is coded in complementary strand; from 3171109 to 3170597)