Sequence retrieval

Genome: Leadbetterella byssophila DSM 17132
Start position: 3122933
End position: 3122995
Length: 63

DNA sequence
>NC_014655, from 3122933 to 3122995 (63 bp); Leadbetterella byssophila DSM 17132 GCAGCAGCAGCTGAATCTAAAACAGCAGCAGCTGAATCAACAGCAGCAGCAGCTTCTTCTACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3122903-3123094	Sequence	Lbys_2783 - hypothetical protein (Protein is coded in complementary strand; from 3123094 to 3122903)