Sequence retrieval

Genome: Leadbetterella byssophila DSM 17132
Start position: 2630320
End position: 2630349
Length: 30

DNA sequence
>NC_014655, from 2630320 to 2630349 (30 bp); Leadbetterella byssophila DSM 17132 CCAGAAAACCCAAGATAACCCCATAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2629449-2630714	Sequence	Lbys_2383 - hypothetical protein (Protein is coded in complementary strand; from 2630714 to 2629449)