Sequence retrieval

Genome: Leadbetterella byssophila DSM 17132
Start position: 2420197
End position: 2420220
Length: 24

DNA sequence
>NC_014655, from 2420197 to 2420220 (24 bp); Leadbetterella byssophila DSM 17132 TTGATCTGGATCTTGATCTTGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2420069-2420290	Sequence	Lbys_2221 - hypothetical protein (Protein is coded in complementary strand; from 2420290 to 2420069)