Sequence retrieval

Genome: Leadbetterella byssophila DSM 17132
Start position: 2123595
End position: 2123648
Length: 54

DNA sequence
>NC_014655, from 2123595 to 2123648 (54 bp); Leadbetterella byssophila DSM 17132 GGAGCTCAAGGACCTGCCGGGCCACAAGGACCTGCCGGAGCCCAAGGACCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2123236-2124210	Sequence	Lbys_2000 - collagen triple helix repeat-containing protein