Sequence retrieval

Genome: Leadbetterella byssophila DSM 17132
Start position: 1961874
End position: 1961897
Length: 24

DNA sequence
>NC_014655, from 1961874 to 1961897 (24 bp); Leadbetterella byssophila DSM 17132 GGTATTGATATTGGTCTTGATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1959865-1962981	Sequence	Lbys_1870 - tonb-dependent receptor plug (Protein is coded in complementary strand; from 1962981 to 1959865)