Sequence retrieval

Genome: Rothia dentocariosa ATCC 17931
Start position: 997286
End position: 997312
Length: 27

DNA sequence
>NC_014643, from 997286 to 997312 (27 bp); Rothia dentocariosa ATCC 17931 GCCCTGCTGGCCCTGTTGGCCTTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 997191-999368	Sequence	HMPREF0733_10946 - serine/threonine protein kinase (Protein is coded in complementary strand; from 999368 to 997191)