Sequence retrieval

Genome: Rothia dentocariosa ATCC 17931
Start position: 501598
End position: 501633
Length: 36

DNA sequence
>NC_014643, from 501598 to 501633 (36 bp); Rothia dentocariosa ATCC 17931 AAACCAGTCAGCAAACCGGCCAGCGAACCAGTCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 500971-502395	Sequence	HMPREF0733_10462 - type II secretion system protein (Protein is coded in complementary strand; from 502395 to 500971)