Sequence retrieval

Genome: Rothia dentocariosa ATCC 17931
Start position: 2404508
End position: 2404552
Length: 45

DNA sequence
>NC_014643, from 2404508 to 2404552 (45 bp); Rothia dentocariosa ATCC 17931 GACCGGTGTGGGGTTGACCGGAGTAGGGGTTACCGGTGTGGGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2403594-2405297	Sequence	HMPREF0733_12139 algP alginate regulatory protein AlgP (Protein is coded in complementary strand; from 2405297 to 2403594)