Sequence retrieval

Genome: Rothia dentocariosa ATCC 17931
Start position: 179744
End position: 179770
Length: 27

DNA sequence
>NC_014643, from 179744 to 179770 (27 bp); Rothia dentocariosa ATCC 17931 GGCTGACCGGGCTGACCGGGCTGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 178580-181282	Sequence	HMPREF0733_10154 - hypothetical protein (Protein is coded in complementary strand; from 181282 to 178580)