Sequence retrieval

Genome: Rothia dentocariosa ATCC 17931
Start position: 1614738
End position: 1614782
Length: 45

DNA sequence
>NC_014643, from 1614738 to 1614782 (45 bp); Rothia dentocariosa ATCC 17931 TCCTGCTTAGGCTGCTCTTGCTTGGGCTGTTCCTGCTTGGGGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1613577-1617242	Sequence	HMPREF0733_11478 - hypothetical protein (Protein is coded in complementary strand; from 1617242 to 1613577)