Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 5075837
End position: 5075899
Length: 63

DNA sequence
>NC_014640, from 5075837 to 5075899 (63 bp); Achromobacter xylosoxidans A8 AGTGCCCGGATTGGTCGGGGTGGTGCCTGGATCGGTCGGGGTCGTACCCGGATCCGTCGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5074851-5077646	Sequence	AXYL_04758 - outer membrane autotransporter barrel domain-containing protein 7 (Protein is coded in complementary strand; from 5077646 to 5074851)