Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 6052697
End position: 6052756
Length: 60

DNA sequence
>NC_014640, from 6052697 to 6052756 (60 bp); Achromobacter xylosoxidans A8 GGGCCGCGTCAGGCCGAGCCGCGTCAGGCCGAGCCGCGTCAGGCCGGGCCGCGTCAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 6052751-6053992	Sequence	AXYL_05643 - diguanylate cyclase (Protein is coded in complementary strand; from 6053992 to 6052751)