Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 6052693
End position: 6052752
Length: 60

DNA sequence
>NC_014640, from 6052693 to 6052752 (60 bp); Achromobacter xylosoxidans A8 AGCGGGGCCGCGTCAGGCCGAGCCGCGTCAGGCCGAGCCGCGTCAGGCCGGGCCGCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 6052177-6052695	Sequence	AXYL_05642 - GNAT family acetyltransferase
ORF... 6052751-6053992	Sequence	AXYL_05643 - diguanylate cyclase (Protein is coded in complementary strand; from 6053992 to 6052751)