Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 6723846
End position: 6723893
Length: 48

DNA sequence
>NC_014640, from 6723846 to 6723893 (48 bp); Achromobacter xylosoxidans A8 TGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6723297-6724280	Sequence	AXYL_06251 - periplasmic solute binding family protein (Protein is coded in complementary strand; from 6724280 to 6723297)