Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 679244
End position: 679288
Length: 45

DNA sequence
>NC_014640, from 679244 to 679288 (45 bp); Achromobacter xylosoxidans A8 TGCGGCCTTCTTCGCTACTGCCTTCTTGGCGGCGGGCTTCTTCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 678657-679322	Sequence	AXYL_00636 hctB histone H1-like protein HC2 (Protein is coded in complementary strand; from 679322 to 678657)