Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 4596661
End position: 4596705
Length: 45

DNA sequence
>NC_014640, from 4596661 to 4596705 (45 bp); Achromobacter xylosoxidans A8 GACGCAGGCGCAGCGCTCGCAGGCGTAGCGGACGCGGGCGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4596544-4597410	Sequence	AXYL_04298 - large tegument domain-containing protein (Protein is coded in complementary strand; from 4597410 to 4596544)