Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3217880
End position: 3217924
Length: 45

DNA sequence
>NC_014640, from 3217880 to 3217924 (45 bp); Achromobacter xylosoxidans A8 CCGGCGGCGGCGGCGGAGGCGGTGGCGGCGGCGGTGGCGGCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3216901-3219963	Sequence	AXYL_03010 - outer membrane autotransporter barrel domain-containing protein 3 (Protein is coded in complementary strand; from 3219963 to 3216901)