Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 793130
End position: 793165
Length: 36

DNA sequence
>NC_014640, from 793130 to 793165 (36 bp); Achromobacter xylosoxidans A8 GGCTCCGGCTTGGGTTCCGGTTTGGGCTGCGGCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 792284-793393	Sequence	AXYL_00744 tolA protein TolA (Protein is coded in complementary strand; from 793393 to 792284)