Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 5511933
End position: 5511968
Length: 36

DNA sequence
>NC_014640, from 5511933 to 5511968 (36 bp); Achromobacter xylosoxidans A8 GCGGCCAGCAGGGCGGCCAGCGTGGCGGCCATGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 5510829-5511965	Sequence	AXYL_05140 - receptor family ligand binding region family protein 25 (Protein is coded in complementary strand; from 5511965 to 5510829)