Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3856906
End position: 3856941
Length: 36

DNA sequence
>NC_014640, from 3856906 to 3856941 (36 bp); Achromobacter xylosoxidans A8 GCGGCCTTGCTGGCGGTCTTGCTGGCAGCCTTGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3856864-3858594	Sequence	AXYL_03593 - hypothetical protein (Protein is coded in complementary strand; from 3858594 to 3856864)