Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 2869921
End position: 2869956
Length: 36

DNA sequence
>NC_014640, from 2869921 to 2869956 (36 bp); Achromobacter xylosoxidans A8 CGGCCTGCTTGTAGGTCTGCTTGTCGGCCTGTTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2869584-2870261	Sequence	AXYL_02682 - lysine transporter LysE (Protein is coded in complementary strand; from 2870261 to 2869584)