Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 1906056
End position: 1906091
Length: 36

DNA sequence
>NC_014640, from 1906056 to 1906091 (36 bp); Achromobacter xylosoxidans A8 GGCGGCAAGCCGGGTGGCAAGCAGGGCGGCAGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1904695-1906509	Sequence	AXYL_01789 rluB ribosomal large subunit pseudouridine synthase B