Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 1333990
End position: 1334025
Length: 36

DNA sequence
>NC_014640, from 1333990 to 1334025 (36 bp); Achromobacter xylosoxidans A8 CCGGCCGCTCCGGCCACTCCGGCCACTCCGGCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1333550-1334056	Sequence	AXYL_01262 secG preprotein translocase, SecG subunit