Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 1057081
End position: 1057116
Length: 36

DNA sequence
>NC_014640, from 1057081 to 1057116 (36 bp); Achromobacter xylosoxidans A8 CTTCCTGGCGTTTTTCCTGGCCTTCTCCCTGGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1057029-1058372	Sequence	AXYL_00980 - cytochrome ubiquinol oxidase family protein