Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 554422
End position: 554451
Length: 30

DNA sequence
>NC_014640, from 554422 to 554451 (30 bp); Achromobacter xylosoxidans A8 GGCGGGCGCCGGCGCGCGTCCGCGCGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 554360-555358	Sequence	AXYL_00526 - inner-membrane translocator (Protein is coded in complementary strand; from 555358 to 554360)