Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 4116806
End position: 4116835
Length: 30

DNA sequence
>NC_014640, from 4116806 to 4116835 (30 bp); Achromobacter xylosoxidans A8 GCCAGCGCGCGCCATAGCGCGCCACCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4116253-4117158	Sequence	AXYL_03833 - LysR family transcriptional regulator (Protein is coded in complementary strand; from 4117158 to 4116253)