Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3394653
End position: 3394682
Length: 30

DNA sequence
>NC_014640, from 3394653 to 3394682 (30 bp); Achromobacter xylosoxidans A8 GCCGCCGTCGCCGCCGGCGCCGCCGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3391870-3398598	Sequence	AXYL_03160 - outer membrane autotransporter barrel domain-containing protein 4 (Protein is coded in complementary strand; from 3398598 to 3391870)