Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 4957821
End position: 4957848
Length: 28

DNA sequence
>NC_014640, from 4957821 to 4957848 (28 bp); Achromobacter xylosoxidans A8 CTGGTTCCTGGTTCTTGGTTCCTGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4957439-4958269	Sequence	AXYL_04643 - hypothetical protein (Protein is coded in complementary strand; from 4958269 to 4957439)