Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 902693
End position: 902719
Length: 27

DNA sequence
>NC_014640, from 902693 to 902719 (27 bp); Achromobacter xylosoxidans A8 GATGGCCAGGATCGCCAGGCTGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 901290-903212	Sequence	AXYL_00843 - sulfatase family protein 2 (Protein is coded in complementary strand; from 903212 to 901290)