Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 5832998
End position: 5833024
Length: 27

DNA sequence
>NC_014640, from 5832998 to 5833024 (27 bp); Achromobacter xylosoxidans A8 GCCGTTGCCGCCATTGCCGCCATTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5827905-5834075	Sequence	AXYL_05451 - outer membrane autotransporter barrel domain-containing protein 8 (Protein is coded in complementary strand; from 5834075 to 5827905)