Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 5553170
End position: 5553196
Length: 27

DNA sequence
>NC_014640, from 5553170 to 5553196 (27 bp); Achromobacter xylosoxidans A8 GGCCGGCGTGGCTGGCGTGGCTGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5550642-5554265	Sequence	AXYL_05180 - hypothetical protein (Protein is coded in complementary strand; from 5554265 to 5550642)