Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 5510630
End position: 5510656
Length: 27

DNA sequence
>NC_014640, from 5510630 to 5510656 (27 bp); Achromobacter xylosoxidans A8 CCCCGGCCACCCCCGCCACCGCGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5509270-5510694	Sequence	AXYL_05139 dacB D-alanyl-D-alanine carboxypeptidase (Protein is coded in complementary strand; from 5510694 to 5509270)