Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 495531
End position: 495557
Length: 27

DNA sequence
>NC_014640, from 495531 to 495557 (27 bp); Achromobacter xylosoxidans A8 GCCGATGCCGCCGAAGCCGACGATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 495055-495990	Sequence	AXYL_00471 serA1 D-3-phosphoglycerate dehydrogenase 1 (Protein is coded in complementary strand; from 495990 to 495055)