Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 4825087
End position: 4825113
Length: 27

DNA sequence
>NC_014640, from 4825087 to 4825113 (27 bp); Achromobacter xylosoxidans A8 CGGCGGCAACGGCGGCGACGCCGGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4824762-4826084	Sequence	AXYL_04499 - outer membrane transporter OMPP1/FadL/TodX family protein