Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3557008
End position: 3557034
Length: 27

DNA sequence
>NC_014640, from 3557008 to 3557034 (27 bp); Achromobacter xylosoxidans A8 GCCACCCGCGCCACCCGTGCCACGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3556849-3557316	Sequence	AXYL_03300 - hypothetical protein (Protein is coded in complementary strand; from 3557316 to 3556849)