Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3293331
End position: 3293357
Length: 27

DNA sequence
>NC_014640, from 3293331 to 3293357 (27 bp); Achromobacter xylosoxidans A8 GTGCTGGCGGCGCTGGCGGTGCTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3292786-3294396	Sequence	AXYL_03077 - dolichyl-phosphate-mannose-protein mannosyltransferase family protein 2