Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3118251
End position: 3118277
Length: 27

DNA sequence
>NC_014640, from 3118251 to 3118277 (27 bp); Achromobacter xylosoxidans A8 GCTTCGGAAGCTTTGGAAGCTTCAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3118273-3118623	Sequence	AXYL_02918 - hypothetical protein (Protein is coded in complementary strand; from 3118623 to 3118273)