Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 3110946
End position: 3110972
Length: 27

DNA sequence
>NC_014640, from 3110946 to 3110972 (27 bp); Achromobacter xylosoxidans A8 TCGGCGTATTCGGCGTATTCGGCGTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3110544-3113135	Sequence	AXYL_02912 - pyruvate, water dikinase (Protein is coded in complementary strand; from 3113135 to 3110544)