Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 2969815
End position: 2969841
Length: 27

DNA sequence
>NC_014640, from 2969815 to 2969841 (27 bp); Achromobacter xylosoxidans A8 CGGGTTGGCCCGGTTGGCCGGGTTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2969436-2969999	Sequence	AXYL_02772 fliL flagellar FliL protein (Protein is coded in complementary strand; from 2969999 to 2969436)