Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 2581018
End position: 2581044
Length: 27

DNA sequence
>NC_014640, from 2581018 to 2581044 (27 bp); Achromobacter xylosoxidans A8 GGCTTGCTGGGCATGCTGGGCGTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2580092-2581126	Sequence	AXYL_02439 ttrC tetrathionate reductase complex subunit C