Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 2166691
End position: 2166717
Length: 27

DNA sequence
>NC_014640, from 2166691 to 2166717 (27 bp); Achromobacter xylosoxidans A8 GACGCCGGCGACGCCGGGGGCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2166611-2166997	Sequence	AXYL_02044 - hypothetical protein (Protein is coded in complementary strand; from 2166997 to 2166611)