Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 1903824
End position: 1903848
Length: 25

DNA sequence
>NC_014640, from 1903824 to 1903848 (25 bp); Achromobacter xylosoxidans A8 CCGCGACGCGCCGGGCCGCCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1903406-1904659	Sequence	AXYL_01788 scpB segregation and condensation protein B