Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 973602
End position: 973625
Length: 24

DNA sequence
>NC_014640, from 973602 to 973625 (24 bp); Achromobacter xylosoxidans A8 GGGCGGTGGCGGGAGCGGGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 973004-974956	Sequence	AXYL_00909 mutL DNA mismatch repair protein MutL (Protein is coded in complementary strand; from 974956 to 973004)