Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 793088
End position: 793111
Length: 24

DNA sequence
>NC_014640, from 793088 to 793111 (24 bp); Achromobacter xylosoxidans A8 GGAGGAGGAGGCGGCGGAGGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 792284-793393	Sequence	AXYL_00744 tolA protein TolA (Protein is coded in complementary strand; from 793393 to 792284)