Sequence retrieval

Genome: Achromobacter xylosoxidans A8
Start position: 6739237
End position: 6739260
Length: 24

DNA sequence
>NC_014640, from 6739237 to 6739260 (24 bp); Achromobacter xylosoxidans A8 CCACGGCCTCGGCCAGGGCCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6738498-6739586	Sequence	AXYL_06269 - D-alanyl-D-alanine carboxypeptidase (Protein is coded in complementary strand; from 6739586 to 6738498)